PedAM

Pediatric Disease Annotations & Medicines


	cartilage-hair hypoplasia

Disease ID	235
Disease	cartilage-hair hypoplasia
Definition	A rare autosomal recessive inherited disorder caused by mutation in the gene for RNAase RMRP. It is characterized by short-limb dwarfism, presence of fine sparse hair, and T-and B-cell immunodeficiency.
Synonym	cartilage hair hypoplasia cartilage hair syndrome cartilage-hair hypoplasia syndrome chh mckusick metaphyseal chondrodysplasia syndrome metaphyseal chondrodysplasia, mckusick type metaphyseal chondrodysplasia, mckusick type (disorder) metaphyseal chondrodysplasia, recessive type
Orphanet	ORPHANET:175
OMIM	OMIM:250250
DOID	DOID:14773
UMLS	C0220748
SNOMED-CT	SNOMEDCT_US_2016_09_01:7720002
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:2) C0002871 \| anemia \| 1 C0024314 \| lymphoproliferative disease \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:1) RMRP \| 6023 \| CLINVAR;CTD_human;ORPHANET
Inferring Gene	(Waiting for update.)
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:47) 973 \| CD79A \| DISEASES 1655 \| DDX5 \| DISEASES 1300 \| COL10A1 \| DISEASES 6659 \| SOX4 \| DISEASES 583 \| BBS2 \| DISEASES 7389 \| UROD \| DISEASES 7350 \| UCP1 \| DISEASES 3589 \| IL11 \| DISEASES 7535 \| ZAP70 \| DISEASES 291 \| SLC25A4 \| DISEASES 9133 \| CCNB2 \| DISEASES 3973 \| LHCGR \| DISEASES 5896 \| RAG1 \| DISEASES 5347 \| PLK1 \| DISEASES 5897 \| RAG2 \| DISEASES 7015 \| TERT \| DISEASES 6208 \| RPS14 \| DISEASES 54913 \| RPP25 \| DISEASES 3590 \| IL11RA \| DISEASES 23545 \| ATP6V0A2 \| DISEASES 318 \| NUDT2 \| DISEASES 2272 \| FHIT \| DISEASES 23405 \| DICER1 \| DISEASES 1785 \| DNM2 \| DISEASES 5979 \| RET \| DISEASES 6663 \| SOX10 \| DISEASES 8556 \| CDC14A \| DISEASES 4942 \| OAT \| DISEASES 3897 \| L1CAM \| DISEASES 959 \| CD40LG \| DISEASES 8643 \| PTCH2 \| DISEASES 100 \| ADA \| DISEASES 3561 \| IL2RG \| DISEASES 1910 \| EDNRB \| DISEASES 2512 \| FTL \| DISEASES 3559 \| IL2RA \| DISEASES 3486 \| IGFBP3 \| DISEASES 91543 \| RSAD2 \| DISEASES 7227 \| TRPS1 \| DISEASES 176 \| ACAN \| DISEASES 3718 \| JAK3 \| DISEASES 2876 \| GPX1 \| DISEASES 7019 \| TFAM \| DISEASES 3551 \| IKBKB \| DISEASES 388015 \| RTL1 \| DISEASES 6223 \| RPS19 \| DISEASES 6023 \| RMRP \| DISEASES
Locus	Symbol \| Locus(Total Locus:1) RMRP \| 9p13.3

Disease ID	235
Disease	cartilage-hair hypoplasia
Integrated Phenotype	HPO \| Name(Total Integrated Phenotypes:104) HP:0001315 \| Reduced tendon reflexes HP:0000286 \| Epicanthus HP:0000592 \| Blue sclerae HP:0011849 \| Abnormal bone ossification HP:0002652 \| Skeletal dysplasia HP:0003016 \| Wide metaphyses HP:0002938 \| Exaggerated lumbar lordosis HP:0000174 \| Abnormality of the palate HP:0001638 \| Cardiomyopathy HP:0002251 \| Aganglionic megacolon HP:0000400 \| Macrotia HP:0002644 \| Abnormal shape of pelvic girdle bone HP:0005871 \| Metaphyseal chondrodysplasia HP:0002213 \| Thin hair shaft HP:0000535 \| Thin, sparse eyebrows HP:0100255 \| Metaphyseal dysplasia HP:0002665 \| Lymphoma HP:0002650 \| Scoliosis HP:0001875 \| Neutropenia HP:0008069 \| Neoplasm of the skin HP:0000248 \| Brachycephaly HP:0002032 \| Esophageal atresia HP:0012722 \| Heart block HP:0003027 \| Mesomelia HP:0002983 \| Micromelia HP:0003312 \| Abnormal form of the vertebral bodies HP:0001377 \| Restricted elbow extension HP:0005930 \| Abnormality of epiphysis morphology HP:0011220 \| Prominent forehead HP:0100543 \| Cognitive impairment HP:0000535 \| Sparse eyebrow HP:0000431 \| Wide nasal bridge HP:0010301 \| Spinal dysraphism HP:0005019 \| Diaphyseal thickening HP:0005280 \| Depressed nasal bridge HP:0000768 \| Pectus carinatum HP:0002024 \| Malabsorption HP:0008070 \| Sparse hair HP:0004279 \| Hypoplastic hands HP:0000457 \| Depressed nasal ridge HP:0000212 \| Gingival overgrowth HP:0005374 \| Cellular immunodeficiency HP:0000772 \| Abnormality of the ribs HP:0001382 \| Hyperextensible joints HP:0001671 \| Abnormality of the cardiac septa HP:0002777 \| Tracheal stenosis HP:0008905 \| Rhizomelia HP:0009832 \| Abnormality of the distal phalanx of finger HP:0003272 \| Abnormality of the hip bone HP:0100729 \| Large face HP:0000960 \| Sacral dimple HP:0002286 \| Fair hair HP:0002024 \| Intestinal malabsorption HP:0003347 \| Impaired lymphocyte transformation with phytohemagglutinin HP:0003307 \| Hyperlordosis HP:0002353 \| EEG abnormality HP:0000774 \| Narrow chest HP:0005692 \| Joint hyperflexibility HP:0008056 \| Aplasia/Hypoplasia affecting the eye HP:0004313 \| Decreased antibody level in blood HP:0001377 \| Limited elbow extension HP:0000486 \| Strabismus HP:0002093 \| Respiratory insufficiency HP:0004810 \| Congenital hypoplastic anemia HP:0001252 \| Muscular hypotonia HP:0002240 \| Hepatomegaly HP:0010306 \| Short thorax HP:0000505 \| Visual impairment HP:0010318 \| Aplasia/Hypoplasia of the abdominal wall musculature HP:0007464 \| Sparse facial hair HP:0001972 \| Macrocytic anemia HP:0005360 \| Susceptibility to chickenpox HP:0003021 \| Metaphyseal cupping HP:0000444 \| Convex nasal ridge HP:0007703 \| Abnormality of retinal pigmentation HP:0001903 \| Anemia HP:0002644 \| Abnormality of pelvic girdle bone morphology HP:0008921 \| Dwarfism, neonatal short-limbed HP:0008450 \| Narrow vertebral interpedicular distance HP:0002750 \| Delayed skeletal maturation HP:0001508 \| Failure to thrive HP:0005616 \| Accelerated skeletal maturation HP:0000944 \| Abnormality of the metaphyses HP:0004625 \| Biconvex vertebral bodies HP:0200055 \| Small hand HP:0008499 \| High-grade hypermetropia HP:0008155 \| Mucopolysacchariduria HP:0000940 \| Abnormal diaphysis morphology HP:0000470 \| Short neck HP:0002251 \| Hirschsprung megacolon HP:0000653 \| Hypotrichosis of eyelashes HP:0001888 \| Lymphocytopenia HP:0006589 \| Flaring of lower rib cage HP:0006487 \| Bowing of the long bones HP:0000545 \| Myopia HP:0002982 \| Tibial bowing HP:0003220 \| Abnormality of chromosome stability HP:0001732 \| Abnormality of the pancreas HP:0100569 \| Abnormal vertebral ossification HP:0008873 \| Disproportionate short-limb short stature HP:0000368 \| Low-set, posteriorly rotated ears HP:0004279 \| Short palm HP:0000463 \| Anteverted nares HP:0002901 \| Hypocalcemia
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:3) HP:0001908 \| Hypoplastic anemia \| 1 HP:0002514 \| Intracranial calcifications \| 1 HP:0001903 \| Anemia \| 1

Disease ID	235
Disease	cartilage-hair hypoplasia
Manually Symptom	UMLS \| Name(Total Manually Symptoms:8) C1000483 \| anemia C0850497 \| immune deficiency C0746882 \| chronic neutropenia C0522274 \| deficiency of humoral immunity C0040053 \| thrombosis C0019570 \| hirschsprung's disease C0006271 \| bronchiolitis C0006267 \| bronchiectasis
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:1) C0002871 \| anemia \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:8)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs199476103	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35657948	T	C
rs727502774	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35657756	C	A
rs727502775	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35658030	-	TCACAGAGTA
rs727502776	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35658027	-	GCTTCACAGAGTAGT
rs727502777	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35658023	-	CTCAGG,CTCAGCTTCACAGAGTA
rs727502778	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35658020	-	GTCCTCAGCTTCACAGAGTAGTAT,GTCCTCAGCTTCACAGA
rs786204684	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35657955	G	A
rs796065036	NA	6023	RMRP	umls:C0220748	CLINVAR	NA	0.37302921	NA	RMRP;CCDC107	9	35657823	-	A

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)

Web
Analytics