| c2 deficiency | ||||
| Disease ID | 1209 |
|---|---|
| Disease | c2 deficiency |
| Definition | Lack of production of functional C2 protein, due to a genetic defect. It is the most common genetic complement deficiency. Ten percent of C2 deficient patient will develop systemic lupus erythematosus at an early age. Patients also present with frequent sinopulmonary infections often with Streptococcus pneumoniae. |
| Synonym | c2d complement component 2 deficiency |
| OMIM | |
| DOID | |
| UMLS | C3150275 |
| Comorbidity | UMLS | Disease | Sentences' Count(Total Sentences:4) C0034069 | pulmonary fibrosis | 1 C0021053 | immunological disease | 1 C0021400 | influenzae | 1 C0021053 | immunological diseases | 1 |
| Curated Gene | Entrez_id | Symbol | Resource(Total Genes:1) |
| Inferring Gene | (Waiting for update.) |
| Text Mined Gene | (Waiting for update.) |
| Locus | (Waiting for update.) |
| Disease ID | 1209 |
|---|---|
| Disease | c2 deficiency |
| Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:2) |
| Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:2) |
| Disease ID | 1209 |
|---|---|
| Disease | c2 deficiency |
| Manually Symptom | (Waiting for update.) |
| Text Mined Symptom | (Waiting for update.) |
Manually Genotype(Total Text Mining Genotypes:0) |
|---|
| (Waiting for update.) |
All Snps(Total Genotypes:2) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
| rs28934590 | 8621452 | 717 | C2 | umls:C3150275 | UNIPROT | Type II human complement C2 deficiency. Allele-specific amino acid substitutions (Ser189 --> Phe; Gly444 --> Arg) cause impaired C2 secretion. | 0.36 | 1996 | C2 | 6 | 31933876 | C | G,T |
| rs9332736 | NA | 717 | C2 | umls:C3150275 | CLINVAR | NA | 0.36 | NA | C2;C2-AS1 | 6 | 31934291 | GTGGACAGGGTCAGGAATCAGGAGTCTG | - |
GWASdb Annotation(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
GWASdb Snp Trait(Total Genotypes:0) | |
|---|---|
| (Waiting for update.) | |
Mapped by lexical matching(Total Items:0) |
|---|
| (Waiting for update.) |
Mapped by homologous gene(Total Items:0) |
|---|
| (Waiting for update.) |
Chemical(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |
FDA approved drug and dosage information(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |
FDA labeling changes(Total Drugs:0) | |
|---|---|
| (Waiting for update.) | |