bardet-biedl syndrome |
Disease ID | 41 |
---|---|
Disease | bardet-biedl syndrome |
Integrated Phenotype | HPO | Name(Total Integrated Phenotypes:25) HP:0001162 | Postaxial hand polydactyly HP:0000580 | Pigmentary retinopathy HP:0002230 | Generalized hirsutism HP:0000470 | Short neck HP:0000426 | Prominent nasal bridge HP:0000135 | Hypogonadism HP:0006101 | Finger syndactyly HP:0004322 | Short stature HP:0010747 | Medial flaring of the eyebrow HP:0000822 | Hypertension HP:0000003 | Multicystic kidney dysplasia HP:0000365 | Hearing impairment HP:0001395 | Hepatic fibrosis HP:0001513 | Obesity HP:0000100 | Nephrotic syndrome HP:0000028 | Cryptorchidism HP:0002167 | Neurological speech impairment HP:0008736 | Hypoplasia of penis HP:0000368 | Low-set, posteriorly rotated ears HP:0000639 | Nystagmus HP:0008724 | Hypoplasia of the ovary HP:0000494 | Downslanted palpebral fissures HP:0001249 | Intellectual disability HP:0000512 | Abnormal electroretinogram HP:0003202 | Skeletal muscle atrophy |
Text Mined Phenotype | HPO | Name | Sentences' Count(Total Phenotypes:16) HP:0001513 | Obesity | 6 HP:0003774 | End-stage renal failure | 2 HP:0000546 | Retinal degeneration | 2 HP:0000110 | Renal dysplasia | 1 HP:0000083 | Renal insufficiency | 1 HP:0100754 | Mania | 1 HP:0000822 | Hypertension | 1 HP:0000618 | Blindness | 1 HP:0010442 | Polydactyly | 1 HP:0002591 | Voracious appetite | 1 HP:0002516 | Intracranial pressure elevation | 1 HP:0012622 | Chronic kidney disease | 1 HP:0000510 | Retinitis pigmentosa | 1 HP:0000556 | Retinal dystrophy | 1 HP:0001250 | Seizures | 1 HP:0002664 | Neoplasia | 1 |
Disease ID | 41 |
---|---|
Disease | bardet-biedl syndrome |
Manually Symptom | UMLS | Name(Total Manually Symptoms:11) |
Text Mined Symptom | UMLS | Name | Sentences' Count(Total Symptoms:4) C0035304 | retinal degeneration | 2 C0022658 | kidney disease | 2 C0035078 | renal failure | 1 C0085655 | polymyositis | 1 |
Manually Genotype(Total Text Mining Genotypes:0) |
---|
(Waiting for update.) |
All Snps(Total Genotypes:33) | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
snpId | pubmedId | geneId | geneSymbol | diseaseId | sourceId | sentence | score | Year | geneSymbol_dbSNP | CHROMOSOME | POS | REF | ALT |
rs113624356 | 25402481 | 379 | ARL4D | umls:C0752166 | BeFree | Furthermore, we show that BBS1 with the M390R mutation, responsible for 30% of all reported BBS disease cases, fails to interact with ARL6-GTP, thus providing a molecular rationale for patient pathologies. | 0.001628651 | 2014 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
rs113624356 | 25402481 | 84100 | ARL6 | umls:C0752166 | BeFree | Furthermore, we show that BBS1 with the M390R mutation, responsible for 30% of all reported BBS disease cases, fails to interact with ARL6-GTP, thus providing a molecular rationale for patient pathologies. | 0.365438769 | 2014 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
rs113624356 | 22940089 | 582 | BBS1 | umls:C0752166 | BeFree | Phenotypic expression of Bardet-Biedl syndrome in patients homozygous for the common M390R mutation in the BBS1 gene. | 0.369238955 | 2012 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
rs113624356 | 23143442 | 583 | BBS2 | umls:C0752166 | BeFree | To investigate the involvement of the Bardet-Biedl syndrome (BBS) gene BBS1 p.M390R variant in nonsyndromic autosomal recessive retinitis pigmentosa (RP). | 0.377663585 | 2012 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
rs113624356 | 25402481 | 582 | BBS1 | umls:C0752166 | BeFree | Furthermore, we show that BBS1 with the M390R mutation, responsible for 30% of all reported BBS disease cases, fails to interact with ARL6-GTP, thus providing a molecular rationale for patient pathologies. | 0.369238955 | 2014 | BBS1;ZDHHC24 | 11 | 66526181 | T | G |
rs113994178 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | NA | 11 | 66510657 | AAGATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCG | - |
rs113994189 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72709480 | A | - |
rs113994190 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72712308 | G | C |
rs113994191 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72722792 | A | C |
rs113994192 | NA | 585 | BBS4 | umls:C0752166 | CLINVAR | NA | 0.368977445 | NA | BBS4 | 15 | 72712242 | A | G |
rs113994195 | NA | 8195 | MKKS | umls:C0752166 | CLINVAR | NA | 0.365710211 | NA | MKKS | 20 | 10413074 | AGTACTACTAA | - |
rs113994196 | NA | 8195 | MKKS | umls:C0752166 | CLINVAR | NA | 0.365710211 | NA | MKKS | 20 | 10412638 | - | CAGG |
rs119466002 | NA | 55212 | BBS7 | umls:C0752166 | CLINVAR | NA | 0.369172942 | NA | BBS7 | 4 | 121854790 | G | A |
rs137852857 | 26085087 | 27241 | BBS9 | umls:C0752166 | BeFree | We show that the Bardet-Biedl syndrome-causing G141R mutation in BBS9 likely results in misfolding of the β-propeller. | 0.363810118 | 2015 | BBS9 | 7 | 33177570 | G | A |
rs137854907 | NA | 84100 | ARL6 | umls:C0752166 | CLINVAR | NA | 0.365438769 | NA | ARL6 | 3 | 97784972 | T | C |
rs141521925 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76346249 | T | C |
rs151344630 | NA | 166379 | BBS12 | umls:C0752166 | CLINVAR | NA | 0.361357209 | NA | BBS12 | 4 | 122742215 | C | G |
rs179363897 | NA | 129880 | BBS5 | umls:C0752166 | CLINVAR | NA | 0.366534468 | NA | BBS5 | 2 | 169492900 | G | A |
rs193922709 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66519695 | G | A |
rs193922710 | NA | 583 | BBS2 | umls:C0752166 | CLINVAR | NA | 0.377663585 | NA | BBS2 | 16 | 56502382 | G | A |
rs193922711 | NA | 583 | BBS2 | umls:C0752166 | CLINVAR | NA | 0.377663585 | NA | BBS2 | 16 | 56497770 | A | - |
rs35520756 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66519725 | G | A |
rs515726134 | NA | 92482 | BBIP1 | umls:C0752166 | CLINVAR | NA | 0.240271442 | NA | PDCD4;BBIP1 | 10 | 110900466 | A | C |
rs515726135 | NA | 54585 | LZTFL1 | umls:C0752166 | CLINVAR | NA | 0.240542884 | NA | LZTFL1 | 3 | 45835653 | A | G |
rs515726136 | NA | 54585 | LZTFL1 | umls:C0752166 | CLINVAR | NA | 0.240542884 | NA | LZTFL1 | 3 | 45827459 | C | A |
rs549625604 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76347713 | - | A |
rs587777829 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66514679 | G | A |
rs727503818 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76346894 | T | - |
rs727503819 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76346895 | T | - |
rs761101213 | NA | 79738 | BBS10 | umls:C0752166 | CLINVAR | NA | 0.365167327 | NA | BBS10 | 12 | 76347298 | A | - |
rs762511626 | NA | 27241 | BBS9 | umls:C0752166 | CLINVAR | NA | 0.363810118 | NA | BBS9 | 7 | 33349108 | T | A |
rs786204444 | NA | 582 | BBS1 | umls:C0752166 | CLINVAR | NA | 0.369238955 | NA | BBS1 | 11 | 66515543 | C | T |
rs797044604 | NA | 80184 | CEP290 | umls:C0752166 | CLINVAR | NA | 0.364895885 | NA | CEP290 | 12 | 88086450 | C | A |
GWASdb Annotation(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
GWASdb Snp Trait(Total Genotypes:0) | |
---|---|
(Waiting for update.) |
Mapped by lexical matching(Total Items:1) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0000426 | Prominent nasal bridge | MP:0004726 | abnormal nasal capsule morphology;HP:0001399 | Hepatic failure |
Mapped by homologous gene(Total Items:1) | ||||
---|---|---|---|---|
HP ID | HP Name | MP ID | MP Name | Annotation |
HP:0000365 | Hearing impairment | MP:0010465 | aberrant origin of the right subclavian artery;HP:0000368 | Low-set, posteriorly rotated ears |
Chemical(Total Drugs:0) | |
---|---|
(Waiting for update.) |
FDA approved drug and dosage information(Total Drugs:0) | |
---|---|
(Waiting for update.) |
FDA labeling changes(Total Drugs:0) | |
---|---|
(Waiting for update.) |