PedAM

Pediatric Disease Annotations & Medicines


	adrenoleukodystrophy

Disease ID	211
Disease	adrenoleukodystrophy
Definition	An X-linked recessive disorder characterized by the accumulation of saturated very long chain fatty acids in the LYSOSOMES of ADRENAL CORTEX and the white matter of CENTRAL NERVOUS SYSTEM. This disease occurs almost exclusively in the males. Clinical features include the childhood onset of ATAXIA; NEUROBEHAVIORAL MANIFESTATIONS; HYPERPIGMENTATION; ADRENAL INSUFFICIENCY; SEIZURES; MUSCLE SPASTICITY; and DEMENTIA. The slowly progressive adult form is called adrenomyeloneuropathy. The defective gene ABCD1 is located at Xq28, and encodes the adrenoleukodystrophy protein (ATP-BINDING CASSETTE TRANSPORTERS).
Synonym	addison disease and cerebral sclerosis addison-schilder disease adrenoleucodystrophy adrenoleukodystrophy (ald) adrenoleukodystrophy (disorder) adrenoleukodystrophy [disease/finding] adrenoleukodystrophy, x-linked adrenomyeloneuropathy ald ald (adrenoleukodystrophy) ald - adrenoleukodystrophy bronze schilder disease leukodystrophies, melanodermic leukodystrophy, melanodermic melanodermic leukodystrophy schilder addison complex schilder-addison complex siemerling creutzfeldt disease siemerling-creutzfeld disease siemerling-creutzfeldt disease x ald x ald (x linked adrenoleukodystrophy) x linked adrenoleukodystrophy x-ald x-ald (x-linked adrenoleukodystrophy) x-linked adrenoleucodystrophy x-linked adrenoleukodystrophy
Orphanet	ORPHANET:139399 ORPHANET:43
OMIM	OMIM:300100
DOID	DOID:10588
UMLS	C0162309
MeSH	D000326
SNOMED-CT	SNOMEDCT_US_2016_09_01:65389002
Comorbidity	UMLS \| Disease \| Sentences' Count(Total Sentences:16) C1565489 \| renal insufficiency \| 2 C0001623 \| adrenal insufficiency \| 2 C0001403 \| addison's disease \| 1 C0042075 \| urological diseases \| 1 C0027765 \| neurological disease \| 1 C0031039 \| pericardial effusion \| 1 C0014130 \| endocrine disorders \| 1 C0026846 \| muscular atrophy \| 1 C0011303 \| demyelinating disorders \| 1 C0030442 \| bulbar palsy \| 1 C0162309 \| x-linked adrenoleukodystrophy \| 1 C1527231 \| adrenomyeloneuropathy \| 1 C0035078 \| renal failure \| 1 C0029124 \| optic nerve atrophy \| 1 C0001623 \| adrenal failure \| 1 C0026847 \| spinal muscular atrophy \| 1
Curated Gene	Entrez_id \| Symbol \| Resource(Total Genes:6) SOD2 \| 6648 \| CTD_human IFNG \| 3458 \| CTD_human HMOX1 \| 3162 \| CTD_human PEX26 \| 55670 \| CTD_human ABCD1 \| 215 \| CLINVAR;CTD_human;GHR;ORPHANET;UNIPROT PEX13 \| 5194 \| CTD_human
Inferring Gene	Entrez_id \| Symbol \| Resource(Total Genes:2) 215 \| ABCD1 \| infer 3123 \| HLA-DRB1 \| infer
Text Mined Gene	Entrez_id \| Symbol \| Score \| Resource(Total Genes:183) 126393 \| HSPB6 \| DISEASES 57595 \| PDZD4 \| DISEASES 5019 \| OXCT1 \| DISEASES 1738 \| DLD \| DISEASES 7165 \| TPD52L2 \| DISEASES 3421 \| IDH3G \| DISEASES 215 \| ABCD1 \| DISEASES 4832 \| NME3 \| DISEASES 79152 \| FA2H \| DISEASES 2222 \| FDFT1 \| DISEASES 1666 \| DECR1 \| DISEASES 2936 \| GSR \| DISEASES 8529 \| CYP4F2 \| DISEASES 10105 \| PPIF \| DISEASES 5193 \| PEX12 \| DISEASES 10944 \| C11orf58 \| DISEASES 4598 \| MVK \| DISEASES 2597 \| GAPDH \| DISEASES 9421 \| HAND1 \| DISEASES 6697 \| SPR \| DISEASES 6301 \| SARS \| DISEASES 9409 \| PEX16 \| DISEASES 847 \| CAT \| DISEASES 826 \| CAPNS1 \| DISEASES 6388 \| SDF2 \| DISEASES 55821 \| ALLC \| DISEASES 81616 \| ACSBG2 \| DISEASES 6535 \| SLC6A8 \| DISEASES 55902 \| ACSS2 \| DISEASES 23205 \| ACSBG1 \| DISEASES 2230 \| FDX1 \| DISEASES 9252 \| RPS6KA5 \| DISEASES 23417 \| MLYCD \| DISEASES 28965 \| SLC27A6 \| DISEASES 5465 \| PPARA \| DISEASES 5264 \| PHYH \| DISEASES 10998 \| SLC27A5 \| DISEASES 10347 \| ABCA7 \| DISEASES 3553 \| IL1B \| DISEASES 23476 \| BRD4 \| DISEASES 27143 \| PALD1 \| DISEASES 175 \| AGA \| DISEASES 23530 \| NNT \| DISEASES 5443 \| POMC \| DISEASES 10058 \| ABCB6 \| DISEASES 7416 \| VDAC1 \| DISEASES 8892 \| EIF2B2 \| DISEASES 60314 \| C12orf10 \| DISEASES 11001 \| SLC27A2 \| DISEASES 1583 \| CYP11A1 \| DISEASES 3073 \| HEXA \| DISEASES 10351 \| ABCA8 \| DISEASES 432 \| ASGR1 \| DISEASES 3756 \| KCNH1 \| DISEASES 5972 \| REN \| DISEASES 185 \| AGTR1 \| DISEASES 2796 \| GNRH1 \| DISEASES 4863 \| NPAT \| DISEASES 6768 \| ST14 \| DISEASES 54995 \| OXSM \| DISEASES 2180 \| ACSL1 \| DISEASES 196394 \| AMN1 \| DISEASES 26353 \| HSPB8 \| DISEASES 1834 \| DSPP \| DISEASES 9453 \| GGPS1 \| DISEASES 146433 \| IL34 \| DISEASES 5192 \| PEX10 \| DISEASES 1636 \| ACE \| DISEASES 4061 \| LY6E \| DISEASES 51 \| ACOX1 \| DISEASES 5194 \| PEX13 \| DISEASES 9497 \| SLC4A7 \| DISEASES 4714 \| NDUFB8 \| DISEASES 8800 \| PEX11A \| DISEASES 10999 \| SLC27A4 \| DISEASES 4597 \| MVD \| DISEASES 3960 \| LGALS4 \| DISEASES 189 \| AGXT \| DISEASES 5190 \| PEX6 \| DISEASES 64137 \| ABCG4 \| DISEASES 5354 \| PLP1 \| DISEASES 10963 \| STIP1 \| DISEASES 9331 \| B4GALT6 \| DISEASES 5162 \| PDHB \| DISEASES 991 \| CDC20 \| DISEASES 947 \| CD34 \| DISEASES 23209 \| MLC1 \| DISEASES 225 \| ABCD2 \| DISEASES 10290 \| SPEG \| DISEASES 5191 \| PEX7 \| DISEASES 79966 \| SCD5 \| DISEASES 6748 \| SSR4 \| DISEASES 3157 \| HMGCS1 \| DISEASES 788 \| SLC25A20 \| DISEASES 3052 \| HCCS \| DISEASES 55670 \| PEX26 \| DISEASES 30 \| ACAA1 \| DISEASES 4158 \| MC2R \| DISEASES 27445 \| PCLO \| DISEASES 226 \| ALDOA \| DISEASES 10957 \| PNRC1 \| DISEASES 219541 \| MED19 \| DISEASES 3988 \| LIPA \| DISEASES 89910 \| UBE3B \| DISEASES 4306 \| NR3C2 \| DISEASES 57515 \| SERINC1 \| DISEASES 20 \| ABCA2 \| DISEASES 224 \| ALDH3A2 \| DISEASES 2109 \| ETFB \| DISEASES 26503 \| SLC17A5 \| DISEASES 6720 \| SREBF1 \| DISEASES 5195 \| PEX14 \| DISEASES 2224 \| FDPS \| DISEASES 37 \| ACADVL \| DISEASES 5826 \| ABCD4 \| DISEASES 5725 \| PTBP1 \| DISEASES 5828 \| PEX2 \| DISEASES 10390 \| CEPT1 \| DISEASES 622 \| BDH1 \| DISEASES 617 \| BCS1L \| DISEASES 3123 \| HLA-DRB1 \| DISEASES 6721 \| SREBF2 \| DISEASES 4536 \| MT-ND2 \| DISEASES 8443 \| GNPAT \| DISEASES 8504 \| PEX3 \| DISEASES 6646 \| SOAT1 \| DISEASES 5824 \| PEX19 \| DISEASES 912 \| CD1D \| DISEASES 5654 \| HTRA1 \| DISEASES 3158 \| HMGCS2 \| DISEASES 26576 \| SRPK3 \| DISEASES 5825 \| ABCD3 \| DISEASES 2556 \| GABRA3 \| DISEASES 6319 \| SCD \| DISEASES 6342 \| SCP2 \| DISEASES 9023 \| CH25H \| DISEASES 186 \| AGTR2 \| DISEASES 64834 \| ELOVL1 \| DISEASES 5476 \| CTSA \| DISEASES 117154 \| DACH2 \| DISEASES 2516 \| NR5A1 \| DISEASES 25803 \| SPDEF \| DISEASES 3155 \| HMGCL \| DISEASES 9314 \| KLF4 \| DISEASES 4879 \| NPPB \| DISEASES 4878 \| NPPA \| DISEASES 3105 \| HLA-A \| DISEASES 4340 \| MOG \| DISEASES 9563 \| H6PD \| DISEASES 190 \| NR0B1 \| DISEASES 5251 \| PHEX \| DISEASES 5256 \| PHKA2 \| DISEASES 414 \| ARSD \| DISEASES 55835 \| CENPJ \| DISEASES 4155 \| MBP \| DISEASES 4099 \| MAG \| DISEASES 3619 \| INCENP \| DISEASES 4145 \| MATK \| DISEASES 10581 \| IFITM2 \| DISEASES 340273 \| ABCB5 \| DISEASES 51128 \| SAR1B \| DISEASES 10478 \| SLC25A17 \| DISEASES 10134 \| BCAP31 \| DISEASES 8671 \| SLC4A4 \| DISEASES 7124 \| TNF \| DISEASES 8605 \| PLA2G4C \| DISEASES 10165 \| SLC25A13 \| DISEASES 9498 \| SLC4A8 \| DISEASES 2195 \| FAT1 \| DISEASES 5830 \| PEX5 \| DISEASES 1589 \| CYP21A2 \| DISEASES 58155 \| PTBP2 \| DISEASES 23543 \| RBFOX2 \| DISEASES 374308 \| PTCHD3 \| DISEASES 3295 \| HSD17B4 \| DISEASES 4043 \| LRPAP1 \| DISEASES 2053 \| EPHX2 \| DISEASES 5365 \| PLXNB3 \| DISEASES 2108 \| ETFA \| DISEASES 80347 \| COASY \| DISEASES 55554 \| KLK15 \| DISEASES 54938 \| SARS2 \| DISEASES 7503 \| XIST \| DISEASES
Locus	(Waiting for update.)

Disease ID	211
Disease	adrenoleukodystrophy
Integrated Phenotype	(Waiting for update.)
Text Mined Phenotype	HPO \| Name \| Sentences' Count(Total Phenotypes:11) HP:0000083 \| Renal insufficiency \| 3 HP:0011096 \| Demyelination \| 2 HP:0000846 \| Hypoadrenalism \| 2 HP:0001698 \| Pericardial effusions \| 1 HP:0002180 \| Neurodegeneration \| 1 HP:0100033 \| Tic disorder \| 1 HP:0007269 \| Spinal muscle wasting \| 1 HP:0000648 \| Optic-nerve degeneration \| 1 HP:0001283 \| Bulbar palsies \| 1 HP:0003202 \| Neurogenic muscle atrophy, especially in the lower limbs \| 1 HP:0008207 \| Addison's disease \| 1

Disease ID	211
Disease	adrenoleukodystrophy
Manually Symptom	UMLS \| Name(Total Manually Symptoms:7) C2364324 \| increased intracranial pressure C1839611 \| n syndrome C1336970 \| visual manifestations C0221505 \| cerebral lesions C0040034 \| thrombocytopenia C0029124 \| optic nerve atrophy C0014130 \| endocrine disease
Text Mined Symptom	UMLS \| Name \| Sentences' Count(Total Symptoms:1) C0029124 \| optic nerve atrophy \| 1

Manually Genotype(Total Text Mining Genotypes:0)
(Waiting for update.)

All Snps(Total Genotypes:57)
snpId	pubmedId	geneId	geneSymbol	diseaseId	sourceId	sentence	score	Year	geneSymbol_dbSNP	CHROMOSOME	POS	REF	ALT
rs11146842	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743056	G	A
rs11146842	17542813	215	ABCD1	umls:C0162309	BeFree	In the case of X-ALD fibroblasts from an ALD patient (R617H), the mutant ALDP was not detected in the cells, but appeared upon incubation with a proteasome inhibitor.	0.61491071	2007	ABCD1	X	153743056	G	A
rs128624213	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153726137	G	A
rs128624214	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153737214	C	G
rs128624215	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736195	C	G,T
rs128624216	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725709	A	G
rs128624217	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725786	T	G
rs128624218	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153726062	G	A
rs128624219	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736232	G	A
rs128624220	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736372	C	T
rs128624221	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736510	C	T
rs128624222	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153737192	G	A,T
rs128624223	7876858	215	ABCD1	umls:C0162309	BeFree	A missense point mutation (Ser515Phe) in the adrenoleukodystrophy gene in a family with adrenomyeloneuropathy: a clinical, biochemical, and genetic study.	0.61491071	1995	ABCD1	X	153740147	C	T
rs128624223	7876858	215	ABCD1	umls:C1527231	BeFree	A missense point mutation (Ser515Phe) in the adrenoleukodystrophy gene in a family with adrenomyeloneuropathy: a clinical, biochemical, and genetic study.	0.126243163	1995	ABCD1	X	153740147	C	T
rs128624223	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740147	C	T
rs128624224	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740155	C	T
rs128624225	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743023	C	T
rs150346282	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743031	G	A
rs17107315	12939655	6690	SPINK1	umls:C0162309	BeFree	One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS).	0.000271442	2003	SPINK1	5	147828115	T	C
rs1799864	22861370	729230	CCR2	umls:C0162309	BeFree	We also studied the relationship between -2518 A > G CCL2 and CCR2 190 A/G polymorphisms and severity of ALD.	0.000271442	2012	CCR2	3	46357717	G	A
rs1799945	10235273	3077	HFE	umls:C0162309	BeFree	To study the role of hemochromatosis gene mutations on the pathogenesis of alcoholic liver disease (ALD), we have analyzed C282Y and H63D mutations on the chromosomes obtained from 95 Japanese alcoholics.	0.001085767	1999	HFE	6	26090951	C	G
rs1800562	10235273	3077	HFE	umls:C0162309	BeFree	To study the role of hemochromatosis gene mutations on the pathogenesis of alcoholic liver disease (ALD), we have analyzed C282Y and H63D mutations on the chromosomes obtained from 95 Japanese alcoholics.	0.001085767	1999	HFE	6	26092913	G	A
rs193922093	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736486	-	C
rs193922094	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740195	T	C
rs193922097	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725687	G	A
rs193922098	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153726104	C	A,T
rs201568579	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740600	G	A
rs2228603	24946282	1463	NCAN	umls:C0162309	BeFree	The frequency of the NCAN rs2228603 T allele was significantly increased in patients with HCC due to ALD (15.1%) compared to alcoholic cirrhosis without HCC (9.3%), alcoholic controls (7.2%), healthy controls (7.9%), and HCV associated HCC (9.1%).	0.000271442	2014	NCAN	19	19219115	C	A,T
rs387906494	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153737178	AG	-
rs387906495	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740155	C	-
rs387906496	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153726137	GAG	-
rs387906497	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725249	GCAGCCAGCCCAGGTGACATGCCGGT	-
rs398123100	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153737159	C	T
rs398123102	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740156	G	A
rs398123103	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740189	G	A
rs398123104	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740599	C	A,T
rs398123105	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740618	C	T
rs398123106	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153740710	C	T
rs398123107	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743008	G	A
rs398123108	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743211	G	A
rs398123109	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725297	CGGGGGAACACGCTGA	-
rs398123110	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725612	G	A
rs398123111	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725672	C	T
rs398123112	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725764	GGTGGCCCACGCCTACCGCCTCT	-
rs398123113	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725880	C	A,T
rs4010613	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743055	C	T
rs713993050	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153725519	-	C
rs727503786	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736231	C	A,G
rs738409	25060292	80339	PNPLA3	umls:C0162309	BeFree	We performed a systematic review of previous studies on the relationship between rs738409 of PNPLA3 and ALD and meta-analysis was conducted in a random-effects model.	0.001085767	2014	PNPLA3	22	43928847	C	G
rs738409	22869157	80339	PNPLA3	umls:C0162309	BeFree	The single nucleotide polymorphism (SNP) rs738409 in patatin-like phospholipase domain-containing protein 3 (PNPLA3) is associated with hepatic fat accumulation and disease progression in patients with non-alcoholic fatty liver disease and alcoholic liver disease (ALD).	0.001085767	2013	PNPLA3	22	43928847	C	G
rs797044610	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153726153	A	G
rs797044611	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1;BCAP31	X	153726152	T	C
rs797044625	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743503	AC	-
rs797044626	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153743487	A	G
rs797044726	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153736408	C	T
rs797044781	NA	215	ABCD1	umls:C0162309	CLINVAR	NA	0.61491071	NA	ABCD1	X	153742986	G	A
rs973742	22253809	912	CD1D	umls:C1527231	BeFree	The minor allele of rs973742 located 4-kb downstream from CD1D was significantly more frequent in AMN patients (χ² = 7.6; P = 0.006).	0.000271442	2012	NA	1	158190738	G	A

GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)

GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)

Mapped by lexical matching(Total Items:0)
(Waiting for update.)

Mapped by homologous gene(Total Items:0)
(Waiting for update.)

Chemical(Total Drugs:0)
(Waiting for update.)

FDA approved drug and dosage information(Total Drugs:0)
(Waiting for update.)

FDA labeling changes(Total Drugs:0)
(Waiting for update.)